Table 1 Resources of plasmids used in the study
From: miR-122-5p regulates the tight junction of the blood-testis barrier of mice via occludin
Plasmid name | Resource | Characteristics |
|---|---|---|
pGL3-miR-122-5p promoter | Shanghai R&S Biotechnology Co. Ltd. (Shanghai, China) | Sequence of miR-122-5p promoter was artificially synthesized and cloned into pGL3 with primer: F,ACTTAACGCGTCCGTGGTCCAGGTGAGTGTC;R: GCCTAAGCTTCTGCTAAGGAAAGTCTGTCAGGC. |
pcDNA3.1-Sp1 | Shanghai R&S Biotechnology Co. Ltd. (Shanghai, China). | CDS of Mus Sp1(Gene ID: 20683) was artificially synthesized and cloned into pcDNA3.1 with primer: F:AAGCTTGCCACCATGAGCGACCA, R:GATATCTTAGAAACCATTGCCACTGATATTAATGGA. |
pcDNA3.1-GATA4 | Shanghai R&S Biotechnology Co. Ltd. (Shanghai, China). | CDS of Mus GATA4 (Gene ID: 14463) was artificially synthesized and cloned into pcDNA3.1with primer: F, GGATCCGCCACCATGTACC, R: TCTAGATTACGCGGTGATTATGTCC. |
Occludin-3’UTR (wt) | Artificially synthesized by Shanghai R&S Biotechnology Co. Ltd. (Shanghai) | Mouse Ocln ENSMUST00000069756, 3’UTR, length: from 1 to 1500 |
Occludin-3’UTR(mu) | Artificially synthesized by Shanghai R&S Biotechnology Co. Ltd. (Shanghai) | The mutant occludin-3’UTR lost a fragment of ACACTCCA at 210–217 (Mouse Ocln ENSMUST00000069756, 3’UTR, length: from 1 to 1500). |
pcDNA3.1 | Promega (Madison, USA) | |
pRL-TK | Promega (Madison, USA) | |
pGL3-basic | Promega (Madison, USA) | |
miR-122-5p mimic/inhibitor siRNA | Guangzhou RiboBio Co., Ltd. (Guangzhou, China). | |
miR-122-5p mimic/inhibitor siRNA NC | Guangzhou RiboBio Co., Ltd. (Guangzhou, China). |