Skip to main content

Table 1 Resources of plasmids used in the study

From: miR-122-5p regulates the tight junction of the blood-testis barrier of mice via occludin

Plasmid name Resource Characteristics
pGL3-miR-122-5p promoter Shanghai R&S Biotechnology Co. Ltd. (Shanghai, China) Sequence of miR-122-5p promoter was artificially synthesized and cloned into pGL3 with primer: F,ACTTAACGCGTCCGTGGTCCAGGTGAGTGTC;R: GCCTAAGCTTCTGCTAAGGAAAGTCTGTCAGGC.
pcDNA3.1-Sp1 Shanghai R&S Biotechnology Co. Ltd. (Shanghai, China). CDS of Mus Sp1(Gene ID: 20683) was artificially synthesized and cloned into pcDNA3.1 with primer: F:AAGCTTGCCACCATGAGCGACCA, R:GATATCTTAGAAACCATTGCCACTGATATTAATGGA.
pcDNA3.1-GATA4 Shanghai R&S Biotechnology Co. Ltd. (Shanghai, China). CDS of Mus GATA4 (Gene ID: 14463) was artificially synthesized and cloned into pcDNA3.1with primer: F, GGATCCGCCACCATGTACC, R: TCTAGATTACGCGGTGATTATGTCC.
Occludin-3’UTR (wt) Artificially synthesized by Shanghai R&S Biotechnology Co. Ltd. (Shanghai) Mouse Ocln ENSMUST00000069756, 3’UTR, length: from 1 to 1500
Occludin-3’UTR(mu) Artificially synthesized by Shanghai R&S Biotechnology Co. Ltd. (Shanghai) The mutant occludin-3’UTR lost a fragment of ACACTCCA at 210–217 (Mouse Ocln ENSMUST00000069756, 3’UTR, length: from 1 to 1500).
pcDNA3.1 Promega (Madison, USA)  
pRL-TK Promega (Madison, USA)  
pGL3-basic Promega (Madison, USA)  
miR-122-5p mimic/inhibitor siRNA Guangzhou RiboBio Co., Ltd. (Guangzhou, China).  
miR-122-5p mimic/inhibitor siRNA NC Guangzhou RiboBio Co., Ltd. (Guangzhou, China).  
  1. 1. UTR:Untranslated Region
  2. 2. siRNA: Small interfering RNA