Figure 1From: Comparative testicular transcriptome of wild type and globozoospermic Dpy19l2knock out miceStrategy for Dpy19l2 KO mice genotyping. A) Scheme of the Dpy19l2 alleles and primers (red arrows) used for their detection. Primer sequence is as follow: 1:GAAGGCTACACCTCTTGCA, 2:GCTGCAGCAACGACCACTTC; 3:CCTAGGAATGCTCGTCAAGA. B) Examples of PCRs with (from left to right) Dpy19l2+/- mouse, Dpy19l2-/- mouse, Dpy19l2+/+ mouse and water (control).Back to article page