Skip to main content

Table 1 Primers used in the study

From: Is ferroptosis involved in ROS-induced testicular lesions in a varicocele rat model?

Genes Forward Primer Reverse Primer Annealing Temp (°C) Product Size (bp)
P53 CCGACTATACCACTACCATAC CACAAACACGAACCTCAAAC 64 147
Nrf2 GCCATTAGTCAGTCGCTCC GTGCCTTCAGTGTGCTTCT 61 98
Slc7a11 TGTCTCCAGGTTATTCTATTTG CCAGAGAAGAGCATTATCATG 54 138
  1. bp base pair, Nrf2 Nuclear factor erythroid 2–related factor, Temp Temperature, °C Degree Celsius